thumbnail image
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Products 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Enzymes
  • POCT 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • Synbio 
    • Synthetic Biology
    • NMN
    • SBS Insights
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Products 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Enzymes
    • POCT 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • Synbio 
      • Synthetic Biology
      • NMN
      • SBS Insights
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Products 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Enzymes
  • POCT 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • Synbio 
    • Synthetic Biology
    • NMN
    • SBS Insights
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Products 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Enzymes
    • POCT 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • Synbio 
      • Synthetic Biology
      • NMN
      • SBS Insights
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
Beijing SBS Genetech Co.,Ltd.
Go Back
Taq-D DNA Polymerase
  • Taq-D DNA Polymerase
  • Taq-D DNA Polymerase

Taq-D DNA Polymerase

$87.00 - $2,600.00
Taq-D DNA Polymerase is a direct-acting Taq DNA polymerase, which is a modified form of Taq DNA polymerase derived from the thermophilic bacterium Thermus aquaticus, recombinantly expressed in Escherichia coli. This enzyme has been genetically engineered and is particularly suitable for amplifying samples containing PCR inhibitors, such as blood. It can amplify DNA fragments up to 3 kb in length. The extension rate is 1.0 kb/min at 72°C. This enzyme exhibits 5'→3' polymerase activity, without 5'→3' exonuclease activity or 3'→5' exonuclease activity. The amplified products have 3'-dA tails. This enzyme is not suitable for Taqman probe-based q-PCR. It is particularly well-suited for single nucleotide polymorphism (SNP) genotyping using the melting curve method.
Select
Quantity
Coming soon
Add to cart
More Details

All products have special prices for bulk purchase, please contact for more details if required.

 

Cat. No.: EDUT-500 (for 500U)

Cat. No.: EDUT-2500 (for 500U×5)

Cat. No.: EDUT-10KU (for 2500U×4)

Cat. No.: EDUT-25KU (for 2500U×10)

 

The lyophilized Taq-D DNA Polymerase is also available by inquiry, which can be transported at room temperature.

We also offer DNA-Free Taq-D DNA Polymerase​, which has undergone a rigorous E. coli DNA removal process.

 

Description

Taq-D DNA Polymerase is a direct-acting Taq DNA polymerase, which is a modified form of Taq DNA polymerase derived from the thermophilic bacterium Thermus aquaticus, recombinantly expressed in Escherichia coli. This enzyme has been genetically engineered and is particularly suitable for amplifying samples containing PCR inhibitors, such as blood. It can amplify DNA fragments up to 3 kb in length. The extension rate is 1.0 kb/min at 72°C. This enzyme exhibits 5'→3' polymerase activity, without 5'→3' exonuclease activity or 3'→5' exonuclease activity. The amplified products have 3'-dA tails. This enzyme is not suitable for Taqman probe-based q-PCR. It is particularly well-suited for single nucleotide polymorphism (SNP) genotyping using the melting curve method.

 

Activity Definition

The enzyme activity is defined as the amount of enzyme required to incorporate 10 nmol of deoxyribonucleotides into acid-insoluble material at 72°C for 30 minutes, using Mahi Mahi sperm DNA as a template/primer, and is expressed as one unit (U).

 

Concentration

5 U/μl

 

Features

  • No exonuclease activity, suitable for single nucleotide polymorphism (SNP) genotyping using the melting curve method.
  • Excellent heat stability: Half-life exceeds 40 minutes at 95°C.
  • Can incorporate dUTP, dITP, and fluorescently labeled nucleotides.
  • Compared to regular Taq DNA polymerase, this enzyme is more suitable for PCR with untreated blood, tissue, saliva, and other samples.

 

Applications

  • Melting curve-based gene typing/SNP analysis.
  • Direct PCR with blood, tissue samples, and more.
  • DNA fluorescent labeling.
  • Colony PCR.
  • Addition of 3’-dA to TA cloning PCR products.

 

Storage
Store at -20°C for one year. Avoid repeated freeze-thaw cycles

 

Note: All product outward appearance, the size color take the material object as. The picture only supplies the reference.

 

Instruction: Protocol

Related: U-Taq DNA Polymerase (Glycerol Free), 2 x Taq PCR MasterMix, Pfu DNA Polymerase, Taq Monoclonal Antibody

 

SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data

 

 

Featured Citations

Interested in seeing published research using our U-Taq DNA Polymerase?

Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay

European Journal of Plant Pathology    |     19 Jan 2023    |    DOI: https://doi.org/10.1007/s10658-023-02639-6

The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.

Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children

Genetic Variation    |    16 Dec 2020    |    DOI: https://doi.org/10.5772/intechopen.94389

The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.

Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia

Journal of Applied Hematology    |    17 Nov 2020    |    DOI: https://doi.org/10.4103/joah.joah_41_20

Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.

Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34

PLOS ONE    |    12 Oct 2020    |    DOI: https://doi.org/10.1007/s10658-023-02639-6

Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)

Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures

JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE   |    6 Oct 2020    |    DOI: https://doi.org/10.5530/jcram.2.2.11

Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.

Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay

Revista FAVE. Sección Ciencias veterinarias   |    1 Aug 2020    |    DOI: https://doi.org/10.14409/favecv.v19i2.9523

La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).

 

 

 

Only for research and not intended for treatment of humans or animals

 

 

Journals Using SBS Genetech Products                                       Universities Using SBS Genetech Products

 

 

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory

  • background image
    background image
    background image
    background image
    background image
    background image
    background image
  • Featured Publications

    We are honored to create value for our customers and facilitate the development of science

SBS Genetech © Copyright 2000-2025

from China, for the World

for Superior Biology Services since 2000

    Home
    Journals
    Contact
    Posts
Cookie Use
We use cookies to ensure a smooth browsing experience. By continuing we assume you accept the use of cookies.
Learn More