thumbnail image
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Home
  • Product 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Synthetic Biology
    • Enzymes
  • POCT Solution 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Home
    • Product 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Synthetic Biology
      • Enzymes
    • POCT Solution 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Home
  • Product 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Synthetic Biology
    • Enzymes
  • POCT Solution 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Home
    • Product 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Synthetic Biology
      • Enzymes
    • POCT Solution 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
Beijing SBS Genetech Co.,Ltd.
Go Back
U-Taq DNA Polymerase (Glycerol Free)

U-Taq DNA Polymerase (Glycerol Free)

$300.00 - $13,500.00
U-Taq DNA Polymerase (Glycerol Free) is a glycerol free formulation of a thermostable enzyme that can withstand prolonged incubation at temperatures up to 95°C without significant loss of activity.
Select
Quantity
Coming soon
Add to cart
More Details

All products have special prices for bulk purchase, please contact for more details if required.

 

Cat. No.: EUGF-10k (for 10KU)

Cat. No.: EUGF-500k (for 500KU)

 

Description

U-Taq DNA Polymerase (Glycerol Free) is a glycerol free formulation of our regular U-Taq DNA Polymerase, which consists of a single polypeptide with a molecular weight of 94 kDa. It has a 5'→3' DNA polymerase activity and lacks 3'→5' exonuclease activity. Its extension rate is 2~4 kb/min in standard conditions, which is the highest among all thermostable DNA enzymes. The appropriate reaction temperature is 70~75℃, the work concentration of dNTPs is 100~300 μM, the work concentration of Mg2+ is 2~3 mM, and the suitable pH is 8.1~9.1. The enzyme generates PCR products with 3'-dA overhangs, suitable for T-A cloning. The amount of enzyme is 1~1.5 unit for 20μl PCR reaction, while 2~3 unit for 50μl PCR reaction. 6 kb Lambda DNA and 2.1 kb Human genomic DNA can be amplified very well at our laboratory.

 

Applications

  • Automated high throughput testing
  • Applications involving lyophilization
  • Robot-aided accurate pipetting
 
Storage
Store at -20°C for one year. Avoid repeated freeze-thaw cycles
 

Related: U-Taq DNA Polymerase, Taq Monoclonal Antibody

 

SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data

 

 

Featured Citations

Interested in seeing published research using our U-Taq DNA Polymerase?

Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay

European Journal of Plant Pathology    |     19 Jan 2023    |    DOI: https://doi.org/10.1007/s10658-023-02639-6

The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.

Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children

Genetic Variation    |    16 Dec 2020    |    DOI: https://doi.org/10.5772/intechopen.94389

The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.

Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia

Journal of Applied Hematology    |    17 Nov 2020    |    DOI: https://doi.org/10.4103/joah.joah_41_20

Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.

Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34

PLOS ONE    |    12 Oct 2020    |    DOI: https://doi.org/10.1007/s10658-023-02639-6

Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)

Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures

JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE   |    6 Oct 2020    |    DOI: https://doi.org/10.5530/jcram.2.2.11

Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.

Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay

Revista FAVE. Sección Ciencias veterinarias   |    1 Aug 2020    |    DOI: https://doi.org/10.14409/favecv.v19i2.9523

La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).

 

 

 

Only for research and not intended for treatment of humans or animals

 

 

Journals Using SBS Genetech Products                                       Universities Using SBS Genetech Products

 

 

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory

  • background image
    background image
    background image
    background image
    background image
    background image
    background image
  • Featured Publications

    We are honored to create value for our customers and facilitate the development of science

SBS Genetech © Copyright 2000-2025

from China, for the World

for Superior Biology Services since 2000

    Home
    Journals
    Contact
    Posts
Cookie Use
We use cookies to ensure a smooth browsing experience. By continuing we assume you accept the use of cookies.
Learn More