U-Taq DNA Polymerase
$1.00 - $1,200.00
All products have special prices for bulk purchase, please contact for more details if required.
Explore Versatile Options with Our Glycerol-Free and Lyophilized Variants
Delight in the flexibility of our product offerings, now available in a glycerol-free version, meticulously crafted to seamlessly integrate with your freeze-drying systems.
Additionally, we present a lyophilized version, a practical solution ensuring stable transportation at room temperature, thereby notably mitigating shipping costs, especially during long-distance transits.
Cat. No.: EUT-500 (for 500U, sample)
Cat. No.: EUT-200k (for 200KU)
The lyophilized U-Taq DNA Polymerase is also available by inquiry, which can be transported at room temperature.
For the glycerol-free version, please visit U-Taq DNA Polymerase (Glycerol Free).
Description
U-Taq DNA Polymerase is a robust thermostable Taq enzyme that consists of a single polypeptide with a molecular weight of 94 kDa. It has a 5'→3' DNA polymerase activity and lacks 3'→5' exonuclease activity. Its extension rate is 2~4 kb/min in standard conditions, which is the highest among all thermostable DNA enzymes. The appropriate reaction temperature is 70~75℃, the work concentration of dNTPs is 100~300 μM, the work concentration of Mg2+ is 2~3 mM, and the suitable pH is 8.1~9.1. The enzyme generates PCR products with 3'-dA overhangs, suitable for T-A cloning. The amount of enzyme is 1~1.5 units for 20μl PCR reaction, while 2~3 units for 50μl PCR reaction. 6 kb Lambda DNA and 2.1 kb Human genomic DNA can be amplified very well at our laboratory.
Components
500U
- U-Taq DNA Polymerase Storage Buffer: U-Taq DNA Polymerase is supplied in 50 mM Tris-HCl (pH8.0), 100 mM NaCl, 0.1 mM EDTA,0.5 mM DTT, 1% TritonX-100, and 50% Glycerol.
- 10 x U-Taq reaction buffer: 500 mM KCI, 100 mM Tris-HCI (pH8.0), 20 mM MgCI2.
Note: All product outward appearance, the size color take the material object as. The picture only supplies the reference.
Instruction: Protocol
Related: U-Taq DNA Polymerase (Glycerol Free), 2 x Taq PCR MasterMix, Pfu DNA Polymerase, Taq Monoclonal Antibody
SBS Genetech is recognized as one of the global major leading industry players in DNA Polymerase by third-party market researchers. For more details, please visit DNA Polymerase Market Size To Reach USD 568.3 Million In 2030 | Rising Demand For Customized DNA Polymerase And Next-Generation DNA Sequencing Are Some Of The Key Factors Driving Market Revenue Growth, Says Reports and Data
Featured Citations
Interested in seeing published research using our U-Taq DNA Polymerase?
Pseudomonas spp. associated with tomato pith necrosis in the Salto area, Northwest Uruguay
European Journal of Plant Pathology | 19 Jan 2023 | DOI: https://doi.org/10.1007/s10658-023-02639-6
The PCR reactions contained 1X PCR buffer, 2.5 mM MgCl2, 0.4 mM of each dNTP, 0.4 μM of each primer, 1 U Taq polymerase (SBS Genetech Co., Ltd., China), and 1 μL of template DNA (100 ng μl−1). The PCR reaction was adjusted to a final volume of 25 μl with MQ water.
Sequencing of Norovirus in Southern, Nigeria: Prevalent Genotypes and Putative GII.4 Novel Recombinants among Children
Genetic Variation | 16 Dec 2020 | DOI: https://doi.org/10.5772/intechopen.94389
The RT-PCR used is a very sensitive method, it can detect as few as 5 x 106 copies per gram of stool sample. U-TaQ DNA polymerase (SBS genetech, Beijing, China), a high-fidelity thermostable enzyme that can withstand prolonged incubation at high temperature up to 95°C without significant loss of activity was used for this RT-PCR protocol.
Semi-nested polymerase chain reaction over blood culture in detection of bloodstream fungal infection in leukemic children with febrile neutropenia
Journal of Applied Hematology | 17 Nov 2020 | DOI: https://doi.org/10.4103/joah.joah_41_20
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Expression, purification and initial characterization of human serum albumin domain I and its cysteine 34
PLOS ONE | 12 Oct 2020 | DOI: https://doi.org/10.1007/s10658-023-02639-6
Total RNA from HepG2 cells was isolated using the RNeasy mini kit (QIAGEN) following manufacturer’s instructions. Retrotranscription was performed using 2.5 μg of RNA, a specific HSA oligonucleotide (ATAAGCCTAAGGCAGCTTGACTGG) and Superscript II reverse transcriptase (Invitrogen). The full-coding sequence of HSA was PCR- amplified with U-Taq (SBS GeneTech)
Evaluation of Nested broad-range PCR for Pathogen Detection in Negative Blood Cultures
JOURNAL OF CLINICAL RESEARCH AND APPLIED MEDICINE | 6 Oct 2020 | DOI: https://doi.org/10.5530/jcram.2.2.11
Taq polymerase enzymes and customized primers were procured from SBS Genetech Co., Ltd., China.
Identificación por catálogo y detección molecular de bovinos Holstein portadores de braquiespina en Uruguay
Revista FAVE. Sección Ciencias veterinarias | 1 Aug 2020 | DOI: https://doi.org/10.14409/favecv.v19i2.9523
La reacción fue puesta a punto en un volumen final de 25µL conteniendo: 100ng de ADN genómico, 2.5µL de Buffer de PCR 10X (Mg2+: 20mM), 1µM de cada primer, 10mM dNTPs y 0.4µL U-Taq ADN polimerasa (SBS Genetech Co., Ltd., China).
Only for research and not intended for treatment of humans or animals
Journals Using SBS Genetech Products Universities Using SBS Genetech Products
SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory