All products have special prices for bulk purchase, please contact for more details if required.

Cat. No.: DIPT-1 (for Set 01 (96 reactions, 24 index pairs))

Cat. No.: DIPT-2 (for Set 02 (96 reactions, 24 index pairs))

Cat. No.: DIPT-3 (for Set 03 (96 reactions, 24 index pairs))

Cat. No.: DIPT-4 (for Set 04 (96 reactions, 24 index pairs))

Description

SBS-NGS™ Dual-Index Primers of Tagmentation (For Illumina) is a specialized dual-index PCR primer kit developed for Tn5 transposase-based library construction on the Illumina sequencing platform. This kit can be used in conjunction with Illumina Nextera-style library preparation kits, such as the SBS-NGS™ DNA Library Quick-Prep Kit (For Illumina) or the Nextera® DNA Sample Preparation Kit (Illumina), to rapidly and efficiently generate sequencing-ready libraries for Illumina platforms.

The SBS-NGS™ Dual-Index Primers of Tagmentation (For Illumina) kit includes four sets (Set01–Set04). Each set contains:

• Four 8-base (nt) i5-tagged P5 primers (SBS-NGS™ Nex i5 Primers)

• Six 10-base (nt) i7-tagged P7 primers (SBS-NGS™ Nex i7 Primers)

When used individually, each set allows cross-combination of P5 and P7 primers to generate 24 unique i5/i7 index pairs. When all four sets are used together, up to 384 unique i5/i7 index pairs can be generated, greatly expanding multiplexing capacity for sequencing libraries.

Primer structures and sequences:

SBS-NGS™ Nex i5 Primers：

5'AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACA*G3'

SBS-NGS™ Nex i7 Primers：

5'CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGCTCTTCCGATC*T3'

Note: * indicates a phosphorothioate bond. i5 and i7 represent the index sequences (Index5 and Index7) used to label and distinguish each sample library. Index sequence details are provided in Appendix Table 1.

Libraries amplified with the SBS-NGS™ Dual-Index Primers of Tagmentation (For Illumina) can be sequenced directly on Illumina platforms without the need for additional sequencing primers. Performance testing has shown uniform sequencing output, with less than 5% variation across replicates using different index primer pairs on the same sample.

The SBS-NGS™ Dual-Index Primers of Tagmentation (For Illumina) kit is compatible with Nextera® DNA Sample Preparation Kit (Illumina, FC-121-1030/1031), Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024/1096), and other Tn5 transposase-based library preparation kits. It enables dual-index labeling of biological samples via PCR amplification, with primer concentration at 10 μM.

Each set of the SBS-NGS™ Dual-Index Primers of Tagmentation (For Illumina) kit supports 96 library indexing reactions.

Components

Set 01

• SBS-NGS™ Nex i5 Primer 01
• SBS-NGS™ Nex i5 Primer 02
• SBS-NGS™ Nex i5 Primer 03
• SBS-NGS™ Nex i5 Primer 04
• SBS-NGS™ Nex i7 Primer 01
• SBS-NGS™ Nex i7 Primer 02
• SBS-NGS™ Nex i7 Primer 03
• SBS-NGS™ Nex i7 Primer 04
• SBS-NGS™ Nex i7 Primer 05
• SBS-NGS™ Nex i7 Primer 06

Set 02

• SBS-NGS™ Nex i5 Primer 05
• SBS-NGS™ Nex i5 Primer 06
• SBS-NGS™ Nex i5 Primer 07
• SBS-NGS™ Nex i5 Primer 08
• SBS-NGS™ Nex i7 Primer 07
• SBS-NGS™ Nex i7 Primer 08
• SBS-NGS™ Nex i7 Primer 09
• SBS-NGS™ Nex i7 Primer 10
• SBS-NGS™ Nex i7 Primer 11
• SBS-NGS™ Nex i7 Primer 12

Set 03

• SBS-NGS™ Nex i5 Primer 09
• SBS-NGS™ Nex i5 Primer 10
• SBS-NGS™ Nex i5 Primer 11
• SBS-NGS™ Nex i5 Primer 12
• SBS-NGS™ Nex i7 Primer 13
• SBS-NGS™ Nex i7 Primer 14
• SBS-NGS™ Nex i7 Primer 15
• SBS-NGS™ Nex i7 Primer 16
• SBS-NGS™ Nex i7 Primer 17
• SBS-NGS™ Nex i7 Primer 18

Set 04

• SBS-NGS™ Nex i5 Primer 13
• SBS-NGS™ Nex i5 Primer 14
• SBS-NGS™ Nex i5 Primer 15
• SBS-NGS™ Nex i5 Primer 16
• SBS-NGS™ Nex i7 Primer 19
• SBS-NGS™ Nex i7 Primer 20
• SBS-NGS™ Nex i7 Primer 21
• SBS-NGS™ Nex i7 Primer 22
• SBS-NGS™ Nex i7 Primer 23
• SBS-NGS™ Nex i7 Primer 24

Storage

Store at –20 °C. Stable for at least one year.

Notes

• Required reagents and materials (not included): DNA size-selection magnetic beads, Ultrapure Water (DNase/RNase-Free, Sterile), magnetic separation rack, 96-/384-well PCR instrument, 96- or 384-well PCR plates, and heat-resistant PCR sealing film. These can also be purchased from us if needed.
• All primers in this product are single-stranded oligonucleotides. Do not expose them to temperatures above room temperature, and avoid repeated freeze–thaw cycles to ensure optimal performance.
• Follow best laboratory practices to prevent cross-contamination of indexed adapters.
• This product is intended for research use only by trained professionals. It must not be used for clinical diagnosis or therapy, food, or pharmaceuticals, and should not be stored in residential settings.
• For your safety and health, always wear a lab coat and disposable gloves when handling this product.