thumbnail image
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Products 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Enzymes
  • POCT 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • Synbio 
    • Synthetic Biology
    • NMN
    • Ambroxan
    • SBS Insights
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Products 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Enzymes
    • POCT 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • Synbio 
      • Synthetic Biology
      • NMN
      • Ambroxan
      • SBS Insights
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
tech@sbsbio.com
Beijing SBS Genetech Co.,Ltd.
Beijing SBS Genetech Co.,Ltd.

from China, for the World

for Superior Biology Services since 2000

  • Products 
    • All Products
    • Custom Services
    • Catalog Products
    • Innovative Systems
    • Nucleic Acid Related
    • Natural Compounds
    • Enzymes
  • POCT 
    • LAMP
    • RPA
    • CRISPR
    • Pathogen Detection
    • DNA-Free Enzymes
    • Freeze-Drying System
    • Lateral Flow System
  • Synbio 
    • Synthetic Biology
    • NMN
    • Ambroxan
    • SBS Insights
  • About 
    • About SBS
    • Achievements
    • Ecosystem
    • Legal Statement
  • Contact
  • …  
    • Products 
      • All Products
      • Custom Services
      • Catalog Products
      • Innovative Systems
      • Nucleic Acid Related
      • Natural Compounds
      • Enzymes
    • POCT 
      • LAMP
      • RPA
      • CRISPR
      • Pathogen Detection
      • DNA-Free Enzymes
      • Freeze-Drying System
      • Lateral Flow System
    • Synbio 
      • Synthetic Biology
      • NMN
      • Ambroxan
      • SBS Insights
    • About 
      • About SBS
      • Achievements
      • Ecosystem
      • Legal Statement
    • Contact
    • Login
Beijing SBS Genetech Co.,Ltd.
Go Back
HLA-B*57:01 Reference Standard

HLA-B*57:01 Reference Standard

Get a Quote
More Details

Format    Genomic DNA

Allele 1    HLA-B*57:01

Allele 2    HLA-B*57:01

Buffer    Tris-EDTA

Exon2    
GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGTGAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGAAGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG

Exon3    
GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACATCGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAGCCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG

Intended Use    Research Use Only

Unit Size    1ug

Storage    2-8°C

Expiry    36 months from the date of manufacture

 

 

 

 

 

 

 

 
 
Only for research and not intended for treatment of humans or animals
 
 

Journals Using SBS Genetech Products                                       Universities Using SBS Genetech Products

 

 

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory

  • background image
    background image
    background image
    background image
    background image
    background image
    background image
  • Featured Publications

    We are honored to create value for our customers and facilitate the development of science

SBS Genetech © Copyright 2000-2025

from China, for the World

for Superior Biology Services since 2000

    Home
    Journals
    Contact
    Posts
Cookie Use
We use cookies to ensure a smooth browsing experience. By continuing we assume you accept the use of cookies.
Learn More