
T3 RNA Polymerase
$45.00 - $1,620.00
$1,800.00
All products have special prices for bulk purchase, please contact for more details if required.
Cat. No.: T3R-1k (for 1KU)
Cat. No.: T3R-5k (for 5KU)
Cat. No.: T3R-25k (for 25KU)
Cat. No.: T3R-100k (for 100KU)
Description
T3 RNA Polymerase is a DNA-dependent 5'→3' RNA polymerase that highly specifically recognizes the T3 promoter sequence. It catalyzes the incorporation of NTPs downstream of the T3 promoter in single-stranded or double-stranded DNA, synthesizing RNA complementary to the template DNA downstream of the T3 promoter.
Features
T3 RNA Polymerase not only performs regular RNA synthesis but also recognizes modified NTPs, such as biotin-labeled, digoxigenin-labeled, and luciferin-labeled NTPs, enabling the synthesis of various labeled RNAs. It exhibits a high specificity for the T3 promoter.
Applications
Used for RNA synthesis. The synthesized RNA can be used for or as: hybridization probes, genomic DNA sequence analysis, RNase protection assay, antisense RNA synthesis, RNA templates for in vitro translation, substrates for RNA splicing studies, RNA secondary structure and RNA-protein interactions, nucleic acid amplification analysis, siRNA, miRNA, and other small RNAs.
Source
Expressed in Escherichia coli, with the expression gene being the T3 RNA Polymerase gene from bacteriophage T3.
Activity Definition
The amount of enzyme required to catalyze the incorporation of 1 nmol of AMP into a polyribonucleotide within 60 minutes at 37°C is defined as one activity unit.
Activity Detection Conditions
40 mM Tris-HCl (pH 8.0), 6 mM MgCl2, 10 mM DTT, 2 mM spermidine, 0.5 mM NTP, 0.6 MBq/ml [3H]-ATP, 20 µg/ml plasmid DNA containing the specific T3 RNA Polymerase promoter sequence.
Purity
Does not contain DNA endonucleases, exonucleases, or RNases.
Enzyme Storage Solution
50 mM Tris-HCl (pH 7.9, 25°C), 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 50% (v/v) glycerol, 0.1% (w/v) Triton X-100.
Transcription Buffer (10X)
400 mM Tris-HCl (pH 7.9, 25°C), 20 mM spermidine, 60 mM MgCl2, 10 mM DTT.
Inactivation or Inhibition
T3 RNA Polymerase can be inactivated by heating at 70°C for 10 minutes. Addition of an appropriate amount of EDTA can also inactivate T3 RNA Polymerase. Chelating agents and sodium, potassium, or ammonium salts at concentrations greater than 150 mM can significantly inhibit the activity of T3 RNA Polymerase.
The T3 consensus promoter sequence is as follows, where G is the first transcribed base:
AATTAACCCTCACTAAAGGGAGA
Precautions
- The enzyme should be stored in an icebox or on ice during use, and after use, it should be immediately placed at -20°C for storage.
- This product is intended for scientific research by professionals only and should not be used for clinical diagnosis or treatment. It is not intended for use in food or drugs and should not be stored in a regular residence.
- For your safety and health, please wear a lab coat and disposable gloves when handling.
Storage
Store at -20°C.










