![T7 Quick High Yield Transcription Kit](https://user-images.strikinglycdn.com/res/hrscywv4p/image/upload/c_limit,fl_lossy,h_1000,w_500,f_auto,q_auto/2311560/327637_508188.png)
T7 Quick High Yield Transcription Kit
$175.00 - $525.00
All products have special prices for bulk purchase, please contact for more details if required.
Cat. No.: T7QHYT-25 (for 25T)
Cat. No.: T7QHYT-100 (for 100T)
Description
T7 Quick High Yield Transcription Kit is a reagent kit developed for large-scale in vitro RNA transcription utilizing the rapid transcription characteristic of T7 RNA Polymerase. This kit enables the synthesis of various types of RNA, such as mRNA, lncRNA, shRNA, in vitro from templates including linearized plasmids carrying the T7 Promoter sequence (TAATACGACTCACTATAGGG), PCR products, or synthetic DNA fragments. The measured yield of RNA per transcription can reach 150-200 μg.
This kit is compatible with modified nucleotides such as m1ψTP and ψTP, allowing the synthesis of mRNA with modifications such as m1ψ. It is also compatible with nucleotides labeled with biotin, digoxigenin, FITC, Cy3, facilitating the synthesis of labeled RNA probes.
The RNA synthesized using this kit can be used for applications such as in vitro translation, transfection for gene expression in cells, RNA structure and function studies, nucleic acid enzyme biochemistry research, RNase protection assays, RNA splicing, microarray analysis, microinjection, and mRNA vaccines, among others.
Through a series of optimizations, this kit can generate 150-200 μg of RNA within 2 hours using only 1 μg of template in a 20 μl reaction system. It exhibits excellent transcription efficiency for both long and short RNA molecules. The reaction system can be scaled up proportionally, allowing for the easy generation of milligram quantities of RNA.
Storage
The minimum shelf life is 1 year at -20°C.
Note
- Due to the involvement of RNA manipulation, strict adherence to RNA handling guidelines is necessary to avoid RNase contamination. Relevant reagents and consumables should be treated with DEPC to remove RNases or ensure they are RNase-free.
- If the synthesis of capped RNA is desired, a Cap analog such as m7(3'-O-methyl)-G(5')ppp(5')G should be prepared separately. For the synthesis of labeled RNA with biotin, digoxigenin, FITC, Cy3, or RNA with specific modifications, the corresponding modified NTPs need to be prepared separately.
- This product is intended for scientific research purposes by professionals only and should not be used for clinical diagnosis or treatment. It should not be used for food or drugs, and should not be stored in residential areas.
- For your safety and health, please wear a lab coat and disposable gloves while handling.
Only for research and not intended for treatment of humans or animals
Journals Using SBS Genetech Products Universities Using SBS Genetech Products
SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory