pCMV-C-mOrange2
All products have special prices for bulk purchase, please contact for more details if required.
The main information of pCMV-C-mOrange2 plasmid is as follows:
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
The map of pCMV-C-mOrange2 plasmid (4996bp) is as follows:
Restriction enzymes that do not cut pCMV-C-mOrange2 include:
|
The single enzyme cutting sites (Restriction enzymes that cut pCMV-C-mOrange2 once) in pCMV-C-mOrange2 include:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The recommended sequencing primer sequences for pCMV-C-mOrange2 plasmid are as follows:
T3 primer (620-639): 5'-AATTAACCCTCACTAAAGGG-3'
C-mOrange2 primer (852-873): 5'- AACCTTCGTATGGACGACCTTC -3'
Storage Conditions
Store at -20 °C.
Precautions
- No commercial use of this plasmid is permitted without written permission from SBS Genetech. Nor shall it be transferred to any individual or institution outside the purchaser’s laboratory.
- This product is intended solely for scientific‑research use by professionals. It shall not be adopted for clinical diagnosis or therapy, food‑related or pharmaceutical applications, nor kept in residential premises.
- For your safety and health, wear a lab coat and disposable gloves during operation.
Only for research and not intended for treatment of humans or animals
Journals Using SBS Genetech Products Universities Using SBS Genetech Products
SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory