All products have special prices for bulk purchase, please contact for more details if required.

The main information of pCMV-Blank plasmid is as follows:

The map of pCMV-Blank plasmid is as follows:

Restriction sites not found in pCMV-Blank include:

The single enzyme cutting sites in pCMV-Blank​ include:

The recommended sequencing primer sequences for pCMV-Blank plasmid are as follows:
T3 primer(620-639): 5′AATTAACCCTCACTAAAGGG 3′
T7 primer(796-817): 5′GTAATACGACTCACTATAGGGC 3′

 

Storage Conditions

Store at -20 °C.

Precautions

• No commercial use of this plasmid is permitted without written permission from SBS Genetech. Nor shall it be transferred to any individual or institution outside the purchaser’s laboratory.
• This product is intended solely for scientific‑research use by professionals. It shall not be adopted for clinical diagnosis or therapy, food‑related or pharmaceutical applications, nor kept in residential premises.
• For your safety and health, wear a lab coat and disposable gloves during operation.

Only for research and not intended for treatment of humans or animals

Journals Using SBS Genetech Products                                       Universities Using SBS Genetech Products

SBS Genetech is a long-term sponsor of Cold Spring Harbor Laboratory